Home Free Lab ReportsInvestigating the impact of Activated Protein C on miR-155 in inflammatory macrophages

Investigating the impact of Activated Protein C on miR-155 in inflammatory macrophages

Investigating the impact of Activated Protein C on miR-155 in inflammatory macrophages.

Acknowledgements
I would like to thank Professor Wim G Meijer, Dr. Raul Miranda-CasoLeungo, for giving me
the opportunity to complete my fourth-year project in the lab. The knowledge and experience
I gained, will without a doubt greatly assist me in my future research endeavours. Thank you
to Dr. Raul Miranda-CasoLeungo and Yuting Yin, for guiding me throughout my whole
project. I am very grateful for your generosity and assistance. I would also like to thank
Professor Dennis Shields in the Conway Institute, who aided me with the bioinformatics part
of my project. Finally, I would like to say a massive thank you to all the members based in
the lab in Science Centre West who helped me along the way and made the experience
enjoyable.

Abstract

List of Figures
Fig 1. The inflammatory response induced by miR-155 in macrophages………………………
Fig 2. Schematic representation of EPCR-dependent PAR1 signaling by APC in endothelial cells………………………………………………………………………………………………
Fig 3. Responsiveness of RAWS 264.7 to APC……………………………………………………
Fig 4. The effect of APC on IL-6 secretion……………………………………………………….

Fig 5. The change in TNF-?, IL-6, and IL-10 mRNA levels in response to APC in LPS stimulated RAW 264.7 cells………………………………………………………………………
Fig 6. Effect of APC on miR-155 synthesis in murine macrophages. ……………………………
Fig 7. The effect of APC on TNF-?, IL-6 and IL-10 protein production in LPS-stimulated RAW 264.7 cell line……………………………………………………………………………………
Fig 8. Effect of APC on miR-155 synthesis in murine macrophages.…………………………….

Fig 9. Changes in TNF-?, IL-6, and IL-10 protein levels in response to APC in LPS stimulated BMDMs…………………………………………………………………………………………
Acknowledgements
Abstract
Table of content
List of Abbreviations
List of Figures
List of Tables

Introduction
microRNAs (miRNAs) are small RNA molecules that play an essential role in mediating functional responses in the cell. They are non-coding endogenous sequences of about 22 nucleotides long with different structural and regulatory activities in animals and plants 5. Although there are 100 – 200 miRNAs genes incorporated in animal genomes, only a small proportion are known to have functions, which are also deemed crucial for the regulation of animal development 3. miRNAs operate by targeting protein-coding messenger RNA (mRNA) for cleavage or translational suppression by partially or accurately base-pairing with complementary sites in the 3′-untranslated regions (3’UTRs) of their marked mRNA 43. It has been proposed that this imperfect pairing between animal miRNA and the target mRNA facilitates the wide scope of mRNAs that can be bound, and thus provides an extensive modulatory potential 3. As a result, an excessive expression or prohibition of miRNAs can cause adverse effects in cellular function 25.
Much work has been expended in trying to determine how miRNAs are activated in cells as well as their target mRNA genes, thus the quest for understanding how these small RNA molecules are deregulated in diseases has intensified. miRNAs are widely implicated in the regulation of many biological systems and their dysfunction has been associated with multiple human diseases including cancer, cardiovascular and inflammatory diseases. As a result, miRNAs have become remarkably useful therapeutic targets for numerous diseases and viral infections 22. One specific miRNA designated miR-155 has been immensely associated with the immune system, since its discovery when the miR-155 encoding gene B-cell integration cluster (BIC) was abundantly expressed in B lymphoma cells. Subsequent research then elucidated that miR-155 was not limited to B cells and was notably specific for hematopoietic cells. Furthermore, it was reported that miR-155 is strongly initiated following the induction of hematopoietic-derived myeloid and lymphoid cells and is fundamental to maintaining an efficient immune response to infection 21, 25.

Intensive research has presented that miR-155 is fundamental for shaping a desirable immune response to infection. Nevertheless, its overproduction can be partly responsible for immune-mediated diseases 25. The aim of this review is to conceptualize the existing literature on the role of miR-155 in the pathogenesis of MS and to provide a basis for the hypothesis that the anti-inflammatory mediator Activated Protein C (APC) could help counteract the effect of miR-155 in inflammatory macrophages.
Multiple Sclerosis
Multiple sclerosis (MS) is an inflammatory demyelinating disease of the central nervous system (CNS). It is described as an acquired neurodegenerative disorder that is associated with immuno-mediated inflammation and results in deterioration of the myelin sheath that encloses nerve cells in the brain and spinal cord. The clinical presentations of MS consist of numerous neurological impairments such as fragile limbs, gait abnormalities and bladder control problems, whereas the pathology is distinguished by lesions in the CNS that can be identified by magnetic resonance imaging (MRI) 25, 35. Moreover, nonspecific symptoms such as fatigue which is experienced by 80% of patients with MS is reported to hinder their quality of life irrespective of their disease status 15. MS is commonly diagnosed in young adults and affects women 2 – 3 times more so than men, with increasing rates of incidence worldwide 25. Individuals aged between 35 and 64 are categorized as the highest prevalence group with MS in Europe, whilst in Ireland it is documented to be between 35 – 44 years of age 35
Although the etiology of MS is undetermined, several subtypes of the disease have been elucidated which help provide an accurate prognosis and appropriate treatment option. Interestingly, the clinical phenotype of MS between patients and within a patient is highly heterogenous, with 85% of recently diagnosed individuals being afflicted with relapsing-remitting MS (RRMS). This disease subtype is characterized by assaults leading to relapses ensued by intervals of recovery, but generally worsening over time. Subsequently, this may advance to secondary progressive MS (SPMS) which is identified by the lack of intervals of amelioration. Primary progressive MS (PPMS) however, begins with a primary attack accompanied by a gradual accumulation of disability without any interim of remission 25, 34.
Genetic predisposition and environmental aspects are also thought to play a role in the onset of MS. With the aid genome-wide association study, the Beecham research group provided a strong basis for genetic contribution to MS by discovering 48 novel variants associated with disease sensitivity. As a result, there are now 110 MS risk genes located in 103 distinct loci that are external of the Major Histocompatibility complex (MHC) 6. Nevertheless, only a small fraction of genes such as the human leukocyte antigen genes from the MHC class II molecules, HLA-DQ and HLA-DR have been confirmed to exhibit an active affiliation with MS 25. In terms of the environmental risk agents, smoking, infectious mononucleosis and Epstein Barr virus infection have been determined to have a firm correlation with MS 7. Taking these factors into account, developing an alternative immunotherapy targeting miR-155, to treat this multifactorial disorder could be highly beneficial.
The role of miR-155 in MS disease progression
The initial connection between miR-155 dysregulation and MS was observed when white matter lesions that were extracted from MS tissue samples contained extensively upregulated levels of miR-155 25. Likewise, another study showcased that tissue collected from MS patients with different disease subtypes also showed that miR-155 was elevated in cerebral white matter 31. It was also determined via laser capture microdissection, that the infiltrating immune cells, myeloid-derived macrophages, T & B lymphocytes, astrocytes and brain-resident cells could produce miR-155. Moreover, increased levels of miR-155 have been recorded in blood mononuclear cells derived from the blood samples of patients with MS. These findings showed that in comparison to alternative miRNAs examined, miR-155 was extensively upregulated in a group of patients with RRMS. This upregulation was also accompanied by increased levels of interleukin (IL) – 6, tumour necrosis factor (TNF) and IL-17 25.
Furthermore, in experimental autoimmune encephalomyelitis (EAE) mice models of MS, it was demonstrated that mice injected with myelin oligodendrocyte glycoprotein (MOG) resulted in a potent invasion of the CNS by CD4+ T helper Th1, Th17 and CD8+ T cells causing tissue injury and inflammation. Intriguingly, mice lacking miR-155 showed decreased quantities of peripheral Th1 and Th17 cells in the CNS. When isolated, these T helper cells exhibited impaired ability to generate IL-17 and interferon (IFN) – as well as weak proliferative activity, thus implying that miR-155 upregulation takes place when cells are in an inflammatory phase. In addition, the role of miR-155 in promoting Th1 and Th17 responses was affirmed when healthy mice were administered an antagomir of miR-155 known as locked nucleic acid (LNA)-miR-155 which counteracted the clinical presentations of later induced EAE. Ultimately, miR-155 is an integral component that elicits disease causing Th1 and Th17 responses 25.The inflammatory response induced by miR-155
Over two decades ago it was ascertained that nearly 50% of the immune cells penetrating the CNS of EAE animal models are indeed macrophages and that elimination of these monocytes by injecting liposomes consisting of cholesterol and phosphatidylcholine fully attenuated the development of EAE 16. In the initial stage of MS, the invading macrophages are instantly induced and transform into M1 macrophages which in turn secret inflammatory cytokines, reactive oxygen species (ROS) and toxic intermediates that lead to irrevocable deterioration of neurons in the CNS. Moreover, it has been shown in in vitro and in vivo studies that polarized M1 macrophages tend to remain localized in MS lesions for extended periods of time, emitting ROS and other toxic compounds that are detrimental to neurons, prohibiting proliferation and resulting in tissue injury 19, 25. In the later phase of MS however, and amid intervals of remission, the macrophages adopt a less activated form known alternatively activated M2 macrophages which are characterized by the release of anti-inflammatory cytokines such as IL-10 and transforming growth factor-beta (TGF-) which contribute to EAE repression and tissue repair 19. Information from numerous studies imply that there is an intimate connection between M1/M2 activation and the levels of miR-155 produced. O’Connell and colleagues revealed that miR-155 was the only miRNA significantly activated by IFN- and that the murine macrophages respond to viral signals by potently increasing miR-155 expression. Also Toll-like receptor (TLR) stimulation experiments using ligands such as lipopolysaccharide (LPS) revealed that miR-155 expression was highly up-regulated 32.

Furthermore, the transcription factors for miR-155 transcriptional induction such as nuclear factor-kB (NF-kB) and hypoxia-inducible factor 1- (HIF1), are also fundamental for the transcription of polarized M1s. HIF1 specifically, has been described to attach to the miR-155 promoter and strengthen its production and has also been implicated in the metabolic remodelling of macrophages to support M1 activity 8, 25. In addition, it was observed in transcriptional profiling data that roughly 650 genes that were obligatory for M1 activation were heavily reliant on miR-155. Contrastingly, macrophages subjected to anti-inflammatory cytokines including IL-13 and IL-4 were noted to drive the alternatively activated M2 macrophages as shown in Fig 1. Moreover, it is postulated that the transition from M1 to M2 macrophages arises from the normal resolution of inflammation, thus describing the restorative nature of M2 macrophages 17.

center787200
Fig 1. The inflammatory response induced by miR-155 in macrophages.

Inhibition of miR-155
Interestingly, mice lacking the M2 stimulant IL-10, undergo rapid disease progression when immunized with the CNS antigen myelin oligodendrocyte glycoprotein, whereas transgenic mice expressing IL-10 are shown to be insusceptible to EAE 11, 39. Hence, the inhibitory effect of IL-10 on miR-155 expression has been examined by several groups. IL-10 is an effective anti-inflammatory cytokine that is fundamental for the down-regulation of pro-inflammatory products. McCoy and associates skilfully illustrated that IL-10 can vigorously suppress the production of both primary-miR-155 and precursor-miR-155 transcripts in a STAT3-dependent method, thus confirming that IL-10 obstructs miR-155 upstream of the primary transcription unit 26. Furthermore, it was revealed that IL-10 could hinder the production of LPS stimulated miR-155 in macrophages, which ultimately liberated the expression of its target gene Src homology 2 domain-containing inositol 5′ phosphatase 1 (SHIP1 10, 26. Moreover, it has been validated that reduced levels of miR-155 can influence the switch to the M2 phenotype, by revoking its suppression on M2-related genes such as IL-13 receptor (IL-13R). IL-13 is a Th2 cytokine which limits Th1 responses and drives M2 macrophages that possess a pro-Th2 profile. Contrastingly, miR-155 inhibition of IL-13R strategically prevents the downstream stimulation of the transcription factor, signal transducer and activator of transcription 6 (STAT6) that leads to the production of Th2 cells. As these pro-Th2 M2 macrophages enhance tissue remodeling and rectify inflammation, it was established that miR-155 assists in the Th1/Th2 balance and preferentially promote the activation of Th1 M1 macrophages which ultimately causes tissue damage 24.

In addition, Cheung and colleagues revealed that the association of IL-10 with its receptor IL-10R results in the induction of the protein tyrosine kinases Jak1 and Tyk2 which in turn leads to the stimulation of the STAT3 pathway. By monitoring IL-10, they discovered that IL-10 employs SHIP1 and STAT3 to block LPS-driven miR-155 production 10. Overall, these findings showcase the anti-inflammatory regulatory capabilities of IL-10 and provide a basis for examining other anti-inflammatory mediators in the regulation of miR-155.
Activated Protein C an anti-inflammatory anticoagulant mediator
Activated protein C (APC) is an ordinary anticoagulant that regulates blood coagulation via proteolytic degradation of procoagulant cofactors such as factor V (FVa) and VIII (FVIIIa) which support the formation of fibrin clots 27. APC is multifunctional and participates in anti-inflammatory, antiapoptotic and cytoprotective processes throughout the body 40. Upon vascular damage, tissue factor (TF) becomes accessible to the blood and induces the production of thrombin which undergoes a multistep enzymatic process, leading to fibrin discharge and platelet stimulation. Uncontrolled production of thrombin however, can lead to adverse effects as it possesses other signalling characteristics that can intensify tissue damage and inflammation 27. Therefore, the presence of an endogenous anticoagulant mediator is imperative for monitoring coagulation-associated inflammation and clot progression.
During clot development, thrombin may bypass into an area of undamaged endothelium, which promotes its complex association with thrombomodulin, a thrombin receptor that extensively expressed on endothelial cells. Once attached, thrombin can no longer process procoagulant substrates for cleavage. Meanwhile, Protein C (PC) exists in the plasma as an inactive zymogen and is initiated when the thrombin-thrombomodulin complex stimulates the endothelial cell PC receptor (EPCR)-bound PC, which facilitates its proteolytic conversion to into the active serine protease known as APC 9, 12, 27. Subsequently, APC can carry out anti-inflammatory activities via the induction of the protease-activated receptor 1 (PAR1), a G protein-coupled receptor on endothelial cells that modulates transmembrane signalling 27, 40. However, the induction of PAR1 by APC necessitates an attachment to EPCR and apolipoprotein E receptor 2. To exert its anticoagulant function, APC must disengage from the EPCR, thus facilitating a complex formation with its cofactor protein S, which can then break down the procoagulant cofactors FVa and FVIIIa. By eradicating the cofactors essential for the intrinsic procoagulant pathway, APC effectively obstructs thrombin formation thus blocking clot development and pro-inflammatory signalling 27.
APC signaling in endothelial cells
Individual research groups have described that the canonical APC signaling pathway occurs via the activation of PAR1 27, 36. In this pathway, APC initiates PAR1 stimulation through proteolytic cleavage of its N-terminal extracellular domain, which results in the uncovering of a tethered ligand that promotes a conformational change in the receptor and interaction with intracellular signaling intermediates 27, 37. Furthermore, existing literature have established that APC cleaves the Arginine residue at position 46 of the PAR1 N-terminal region which confers barrier protective signaling in endothelial cells., thus demonstrating a selective agonism for PAR1 4. Contrastingly, the procoagulant protease thrombin cleaves PAR1 at Arg-41 which triggers cytotoxic responses in the endothelial barrier 27, 37. According to the hypothetical model deduced by Roy and colleagues’, the occupancy of the EPCR by APC causes the receptor to disengage form caveolin-1 in the lipid rafts. Following this, cleavage of PAR1 after Arg-46 site induces a GPCR kinase termed GRK5 which augments the recruitment of ?-arrestin – 2 and dishevelled – 2 (Dvl – 2). The expression and polymerization of Dvl – 2 is requisite for the induction of Ras-related C3 botulinum toxin substrate 1 (Rac1), a small signaling guanine nucleotide-binding protein which is involved in the cytoprotective effects mediated by APC 27. Following proteolysis, the N-terminal cytoplasmic domain of PAR1 undergoes a GRK-mediated phosphorylation process and is prevented from interacting with the G subunit of the heterotrimeric G proteins. As shown in Fig 2, the recruitment of ?-arrestin-2 and Dvl-2 results in a ?-arrestin-2 biased PAR1 signaling which ultimately initiates Rac1 GTPase and impedes NF-kB signaling, thus promoting barrier protective responses 37. Moreover, EPCR is ascribed to be a fundamental co-receptor for APC signaling through PAR1 and is speculated to facilitate a decisive positioning of APC for effective PAR1 proteolysis. Interestingly, EPCR engagement by APC without PAR1 cleavage has also been revealed to mediate PAR1 signaling effects. The exact mechanism of this occurrence however, is not well understood 27.

-18161035052000
left10436Fig 2. Schematic representation of EPCR-dependent PAR1 signaling by APC in endothelial cells. APC occupies EPCR which triggers receptor detachment from caveolin-1. EPR-APC complex cleaves PAR1 after Arg-46 site and initiates GRK5 which drives the recruitment of ?-arrestin – 2 and Dvl – 2. GRK5 mediates the phosphorylation of cytoplasmic N-terminus of PAR1 which impairs its ability to interact with the heterotrimeric G proteins. Downstream signaling leads to the activation of Rac1 GTPase which inhibits NF-kB activity.
00Fig 2. Schematic representation of EPCR-dependent PAR1 signaling by APC in endothelial cells. APC occupies EPCR which triggers receptor detachment from caveolin-1. EPR-APC complex cleaves PAR1 after Arg-46 site and initiates GRK5 which drives the recruitment of ?-arrestin – 2 and Dvl – 2. GRK5 mediates the phosphorylation of cytoplasmic N-terminus of PAR1 which impairs its ability to interact with the heterotrimeric G proteins. Downstream signaling leads to the activation of Rac1 GTPase which inhibits NF-kB activity.

APC signaling in monocytes and macrophages
Following the discovery that APC could ameliorate sever sepsis in patients and was authorized as an anti-sepsis biotherapeutic drug, extensive research has been exerted into understanding its mechanism of action. Cao and associates, identified that the anti-inflammatory function of APC on macrophages is contingent upon the presence of Mac-1 but not EPCR. They strategically illustrated that Mac-1 attachment to APC within the lipid rafts mediates the proteolysis of PAR1 which ultimately leads to the inhibition of pro-inflammatory responses of LPS-stimulated macrophages. Furthermore, genetic inactivation of Mac-1 revealed that macrophage engagement with immbolized APC was blocked. Subsequently, they discovered that the incorporation of a Mac-1 specific antagonist known as neutrophil inhibitory factor (NIF) disrupted the ability of APC to repress IL-6 in wildtype and EPCR deficient macrophages 9.

The B2-integrin Mac-1 also known as CD11b/CD18 is an essential adhesion molecule that is primarily expressed on macrophages and monocytes, and has been proven to associate with multiple ligands to confer diverse biological functions. Moreover, Mac-1 has been validated to conjoin with the intracellular adhesion molecule-1 (ICAM-1) on endothelial cells to arbitrate leukocyte attachment to the vascular wall 13. Current literature articulates that of the four major B2-integrins expressed by macrophages, Mac-1 is the most copious and functional receptor and has been implicated in numerous leukocyte-associated responses such as phagocytosis, adhesion and migration. 33.
APC as a potential antagonist of miR-155 activity in macrophages
As MS is an inflammatory T-cell mediated disorder of the CNS, researchers have examined the impact of APC on T cell responses. For example, it was demonstrated that the delivery of recombinant human activated protein C (rhAPC) in vivo lowered the disease intensity of EAE in mice, and inhibited the expression of Th1 and Th17 cytokines 40. Although EPCRs are not highly expressed on T cell subsets, they are elevated under settings that influence differentiation of Th17 cells which are linked to various autoimmune diseases. EPCR expression however, is known to be associated with non-pathogenic Th17 cell profile, and exerts an inhibitory effect on Th17 differentiation in vitro, thus making APC an intrinsic negative regulator of Th17 cell pathogenicity 27. As miR-155 is a driving force in Th1 and Th17 responses, the administration of APC could possibly counteract this effect.
Furthermore, APC has been confirmed to be useful in decreasing the symptoms of other Th17 – mediated autoimmune disorders in mice models such as systemic lupus erythematosus and asthma 27. In previous studies of mice models, the preventative impact of APC on lung inflammation after exposure to LPS displayed a reduced generation of TNF- by monocytes and a diminished pulmonary leukocytes infiltration 30. In addition, APC has also been tested in acute respiratory distress syndrome (ARDS) and severe sepsis, both of which have showcased the efficiency of APC as a therapeutic agent 1, 40.
Recent studies have postulated that the anti-inflammatory effects of APC on myeloid cells are facilitated by the binding of APC with the CD11b integrin on macrophages 1. As EPCR is restricted on macrophages, it has been established that CD11b acts as a replacement for the coreceptor PAR1 and that the inhibition of LPS-driven inflammatory cytokines secretion by macrophages can occur independently of EPCR but demands the presence of CD11b/CD18 leukocyte integrin 38. In addition, APC signaling via Mac-1 – dependent PAR1 has been displayed to prohibit LPS-induced NF-kB activity and IL-6 secretion from macrophages 9, 27. Incubation with miR-155 has been reported to strongly influences the expression and release of pro-inflammatory cytokines such as TNF, IL-6 and IL-1 from brain cultures 25. Thus, the application of APC may potentially counteract the pro-inflammatory signature of miR-155.
Interestingly, APC also lowers LPS-induced production of TNF- by monocytes by obstructing NF-kB, an essential transcription factor of miR-155 25, 30. What’s more, APC has been shown to suppress the expression of c-Rel, a constituent of the NF-kB family, on endothelial cells derived from the human coronary artery. sIn contrast to miR-155, APC can increase anti-inflammatory cytokines such as IL-10 in response to LPS stimulation, via PAR-1 and the p38 mitogen-activated protein kinase pathway. Not only can IL-10 subdue pro-inflammatory cytokines, it can also control the coagulation process by repressing the production of TF on monocytes 40. This provides a basis for the potential of APC to counterbalance the inflammatory activity of miR-155.
The multifaceted effects of APC are demonstrative of its wide associations with numerous diseases and its potential to become a beneficial therapeutic target. Hence, this provides us with a rational for investigating the impact of APC on pro-inflammatory cytokines and miR-155 which are characteristic of MS disease.
Conclusion
In conclusion, APC may provide a potential therapy for MS via inhibition of miR-155. Overall, the plethora of literature provided propose a valuable role for APC in the inflammatory process of MS, as it possesses anti-inflammatory and neuroprotective abilities and therefore challenges the field of miRNA research. Future research into the impact of APC on miR-155 will broaden the present therapeutic strategies for MS and possibly other inflammatory diseases.
Aims
To investigate the impact pf APC on the production of TNF-, IL-6 and IL-10 in macrophages.
To determine whether APC inhibits miR-155
Methods
Material and Methods
Materials
The RNeasy Mini Kit for RNA extraction was purchased from Qiagen. DMEM 5796, LPS from Escherichia coli, Serotype 0111:B4, 200 proof 99.5% Ethanol, ?-mercaptoethanol, Tween® 20 and BSA were from Sigma-Aldrich. Human activated protein C was acquired from Haematologic Technologies Inc. PPACK-APC was kindly provided by Dr. Erin Suole of RCSI. Nuclease-free DEPC-Treated Water was purchased from Ambion. The mouse DuoSet ELISA Development kit for TNF-, IL-10, IL-6 as well as the recombinant mouse IL-10 used for stimulation were ordered from R&D Systems. Sulfuric acid 5M (10N) was from Fisher chemical and the TMB substrate solution was from Thermo Scientific™. The primers used in this study were previously designed by the McCoy lab and purchased from Sigma – Aldrich. The High Capacity cDNA Reverse Transcription Kit, the MicroAmp® 8-Tube Strip (0.2mL), MicroAmp® 8-Cap Strip, the MicroAmp® Optical 384-well reaction plates and the MicroAmp™ optical adhesive films were from Applied Biosystems. The TaqMan™ MicroRNA Reverse Transcription Kit, the TaqMan® MicroRNA Assays kit and the TaqMan® Fast Advanced Master Mix were bought from Applied Biosystems.
Cell Culture
Maintenance of cell lines
Mouse macrophage cell line RAWS 264.7 and BMDMs (from Dr. Jennifer Dowling, RCSI) were maintained in DMEM containing 10% FBS and 1% penicillin-streptomycin. For serum free media experiments, DMEM was not supplemented with FBS. Cells were grown in a T-75 flask and were kept in a humidified incubator at 37°C in 5% CO2. The cells were split in a 1 in 5 dilutions every 3 days. During subculture, the cells in the flask were washed twice with sterile PBS to remove any remnants of media. Cells were incubated with 1ml of 1X Trypsin-EDTA for 5 mins, to degrade the cell bands on the flask. A cell scrapper was used to dislodge the cells bound to the flask. Once moving freely, the cells were resuspended in 9ml DMEM and centrifuged at 14000 RPM for 5 min. The supernatant was discarded and the pellet of cells was resuspended in 10ml DMEM. Cell viability was ascertained using Trypan blue and cells were quantified using a haemocytometer or automatic cell counter.
Cell stimulation
Cells utilized for experiments were plated at a density of 1 X 106 cells/ml in 96-well or 24-well plates and placed in an incubator overnight. LPS was diluted from a stock of 1mg/ml to 100ng/ml in DMEM or serum-free media, and was used at this final concentration in all experiments. Recombinant mouse IL-10 stock of 20?g/ml was diluted to a final concentration of 20ng/ml in DMEM or serum-free media. Human APC was diluted from a stock concentration of 46?m to a working solution of 500nM. Inactivated APC was diluted to a final concentration of 1000nM. PPACK-inhibited APC was prepared by pre-incubating 10?M of APC in PBS++ with 5-fold molar excess of PPACK for 30 mins. RAWS 264.7 were stimulated with LPS for 6 hrs as indicated in the figure legends and APC was consistently added for 4 hrs, prior to the stimulant. Cell stimulation was ended by transferring the cell supernatant to new 96-well or 24-well plates and cells were lysed with RLT buffer which was formulated from 10?L of ?-mercaptoethanol per 1ml of RLT lysis buffer. Cell lysate and supernatants were stored in a -80°C freezer until later use. Enzyme-linked Immunosorbent Assay
After cell stimulation, the supernatants were analyzed for murine TNF-, IL-10 and IL-6 expression, using ELISA kits as per manufacturer’s instructions (R;D Biosystems). ELISA. The capture antibody was diluted to the working concentration in 1X PBS (pH 7.2 – 7.4). Subsequently, the 96-well microplates were coated with 50?l per well of the diluted capture antibody, sealed with cling film and aluminium foil and incubated overnight at room temperature. Coating antibody was removed by aspiration and rinsing with wash buffer consisting of 1X PBS and 0.05% Tween. The wash step was conducted three times for a total of three washes and the remaining liquid was eliminated by blotting on tissue paper. The plates were blocked for 1 h by adding 150?l per well of Reagent Diluent composed of 1% w/v BSA in 1X PBS. The wash step was repeated to prepare the plates for sample and supernatants. A top standard was prepared for IL-6 (1000pg/ml), TNF- and IL-10 (2000pg/ml) which were then used to generate seven, two-fold serial dilutions in Reagent Diluent. The supernatants were thawed on ice and diluted to 1:10 or 1:25 dilutions in Reagent diluent. 50?l of samples and standards were placed in each well of the 96-well microplates, two technical replicates of the standards and blanks containing only assay diluent were pipetted to generate a standard curve for sample analysis. The plates were covered and incubated for 2 hrs at room temperature. The wash step was repeated to prepare the plates for the detection antibody. The detection antibody was diluted in Reagent Diluent and 50?l was added to each well of the plate. After a 2 hrs incubation period and a wash step, 50?l of a working dilution of Streptavidin – HRP was dispensed into each well, wrapped in film and left for 20 min at room temperature in a dark area. After another wash step, the plates were incubated with 50?l of TMB substrate solution and covered until a blue colour developed within the wells. Once the samples had developed a blue colour that falls within the standards, the reaction was stopped by adding 50?l of sulfuric acid stop solution made up of 2N of 5M sulfuric acid (diluted from 10N) and distilled water. Upon acidification, the samples and standards develop a yellow colour with an absorbance peak at 450nm that can be measured using a spectrophotometer. Microsoft Excel was used to generate the standard curve and to determine the concentrations by linear regression analysis.
RNA extraction
The modified protocol of RNA extraction applied was derived from the Qiagen RNeasy Mini Kit which ensured the isolation of total RNA therefore allowing for the analysis of miRNAs and mRNA from the same sample. All steps were conducted using RNase-free reagents (Qiagen) and filter tips in a fume hood, until ?-mercaptoethanol was extracted from the cell lysates. RNA degradation was stalled by placing the samples on ice.
After thawing, cell lysates containing RLT buffer were resuspended in 1 volume of 70% or 100% ethanol as indicated in the figure legends. Thorough mixing was ensured by pipetting up and down several times. In 96-well plate experiments, three wells containing the same biological replicates were pooled to maximize the yield of RNA. Up to 700?l of the sample was transferred into an RNeasy Mini spin column placed in a 2ml collection tube and centrifuged for 15 s at ? 8000 x g. The eluted liquid in the collection tube was discarded and the tube was dried by tapping on a piece of tissue. A volume of 700?l of RW1 buffer (Qiagen) was added to the column which was then centrifuged for 15 s at ? 8000 x g and the flow-through was disposed of. The columns were washed by pipetting 500?l of RPE buffer, followed by centrifugation at ? 8000 x g for 15 s. The wash step was repeated at ? 8000 x g for 2 min to certify the ethanol was removed. The column containing the RNA was placed in a new 1.5ml microcentrifuge tube and 30?l of RNase-free water was added precisely to the spin column membrane without disrupting it. The microcentrifuges encompassing the columns were centrifuged for 1 min at ? 8000 x g to obtain the eluate containing the RNA and were placed on ice immediately after. RNA concentration of the samples was then determined by pipetting 2?l of eluent onto a Nanodrop machine. The Nanodrop machine was previously cleaned and blanked with nuclease-free DEPC-treated water. Once the RNA concentration of each sample was determined, each RNA stock was diluted according to the lowest ng/?l concentration using DEPC water. RNA samples were then stored in -80°C freezer indefinitely.
Primers for Real-Time PCR amplification
The primers utilized to amplify the genes of interest were provided by the McCoy lab. GAPDH and m18S were chosen as house-keeping genes. The list of primer sequences used in this study are outlined below in Table 1
Table 1. Primers used for RT-PCR amplification
Gene Strand Primer Sequence
m18S F 5 GTAACCCGTTGAACCCATT
m18S R 5 CGAATCGAATCGGTAGTAGCG
GAPDH F 5 CTGCCACCCAGAAGACTGTCC
GAPDH R 5 GTCATACCAGGAAATCAGC
TNF- F 5 GCCTCTTCTCATTCCTGCTT
TNF- R 5 TGGGAACTTCTCATCCCTTTG
IL-6 F 5 ATGGATGCTACCAAACTGGAT
IL-6 R 5 TGAAGGACTCTGGCTTTGTCT
IL-10 F 5 CAGAGAAGCATGGCCCAGAA
IL-10 R 5 AGAAATCGATGACAGCGCCT
Gene Expression Reverse Transcription
The diluted RNA samples were thawed on ice whilst the appropriate volumes of the reagents needed for the reverse transcription stage of Real-Time PCR were prepared. All the reagents from the High Capacity cDNA Reverse Transcription Kit were kept on ice. The RT reaction master mix was set up as shown in Table 2. These quantities were multiplied by the number of samples obtained (+2 for pipetting error).
Table 2. Gene Expression RT reaction mix
Reagent Volume (?l)
dNTP 0.8
10X Buffer 2
RNase Inhibitor 0.5
Random Primers 2
RT Enzyme 1
H2O (RNase and DNase-free)5.7
One master mix containing the desired total volume was prepared and 12?l was pipetted into each MicroAmp® 0.2mL 8 – tube strips. 8?l of RNA was added to each PCR tube which was then capped with MicroAmp® 8 – cap strips and placed in a microcentrifuge for 5 s to make sure all the liquid descends to the bottom. The samples were run on a Thermal Cycler PCR machine using the programme: 25 °C for 10 min, 37 °C for 120 min, 85 °C for 5 min, and 15 °C for ?. Once the PCR reaction was completed, the cDNA samples were diluted with 20?l of DEPC water, spun down and stored in a -20 °C freezer until later use for Real time PCR.
Gene Expression Real-Time PCR
The cDNA samples generated from the RT stage were thawed on ice and combined with the individual master mix for each target gene and house-keeper gene. Each master mix was made up according to the guidelines in Table 3 and each sample was run in technical triplicates for each gene that was examined (+2 for pipetting error).
Table 3. Gene Expression Real – Time PCR Reaction Mix
Reagent Volume (?l)
2X SYBR Green Master Mix 5
5?M Forward Primer 0.5
5?M Reverse Primer 0.5
H2O (RNase and DNase-free) 2
After a master mix was assembled for each gene of interest and housekeeping gene such as m18s and GAPDH, the mixtures were vortexed to ensure complete mixing. A MicroAmp® Optical 384-well reaction plate was labelled with the layout of the experimental set up. Each well was pipetted with 8?l of the relevant master mix, followed by 2?l of the appropriate cDNA sample. The reaction plate was then sealed with an optical adhesive film and the extended sides were peeled off. The Real-Time PCR plate was then centrifuged at 1000 x g for 1 min and then placed in a 7900HT Real-Time PCR System and analysed using Absolute Quanti?cation (??Ct) in the SDS v2.4 software. A dissociation constant was applied to verify that the primers annealed to the genes of interest.
miRNA Reverse Transcription
All the reagents from the TaqMan™ MicroRNA Reverse Transcription Kit and the desired primers such as sno202 and miR-155 from the TaqMan® MicroRNA Assays kit were thawed on ice. A RT reaction master mix was prepared as described in Table 4 and multiplied by the number of samples to be analysed (+2?l for pipetting error).
Table 4. miRNA RT Reaction Mix
Reagent Volume (?l)
dNTP 0.125
10X Buffer 1.5
RNase Inhibitor 0.09
RT Enzyme 1
TaqMan primer (3x) 0.0375 (* each primer)
H2O (RNase and DNase-free) 8.16

A volume of 12?l was placed in each MicroAmp® 0.2mL 8 – tube strips and 3?l of RNA was added on to obtain a total reaction volume of 15?l. The PCR tubes were capped with and spun in a microcentrifuge for 5 s. The samples were run on a Thermal Cycler PCR machine using the programme:16 °C for 30 min, 42 °C for 30 min, 85 °C for 5 min, and 15 °C for ?. The miRNA cDNA obtained was kept neat and stored in a -20 °C freezer.
miRNA Real-Time PCR
The miRNA cDNAs, the TaqMan Fast Advanced Master Mix and the appropriate probes such as miR-155 and sno202, from the TaqMan® MicroRNA Assays kit were thawed on ice. An individual master mix was prepared for each miRNA as outlined in Table 5, and each sample was run in technical triplicates for each miRNA that was analysed ((+2 for pipetting error).

Table 5. miRNA Real – Time PCR Reaction Mix
Reagent Volume (?l)
2X TaqMan Universal Master Mix 5
H2O (RNase and DNase-free) 4
20X probe 0.33
Each master mix was vortexed and 8.9?l was pipetted into each well of a carefully labelled 384-well Real-Time PCR plate. After spinning the miRNA cDNA samples, 1?l was then added to each appropriate well. Once complete, the 384-well plate was covered optical adhesive film and centrifuged at 1000 x g for 1 min. Then the plate was loaded into a 7900HT Real-Time PCR System and analyzed using standard curve in the SDS v2.4 software.
Statistical analysis
The experiments performed in 96- well plates were repeated in two independent experiments and those performed in 24-well plates were carried out in three biological replicates. All gene and miRNA assays were performed in technical triplicates. The data was assessed using Excel and transported to the GraphPad Prism 7.03 software to generate graphs and expressed as the mean ± SD. All gene and miRNA ?Ct data were normalized to non-treated ?Ct. The fold change was obtained using the formula 2-(??Ct). A nonparametric unpaired two-tailed t-test was generated to determine p-values. P-values ? 0.05 were classified as statistically significant. One star (*) signifies a p-value ? 0.05, (**) is a p ? 0.01 and (***) represents a p ? 0.001.
Results
Responsiveness of RAW 264.7 to APC
As the murine macrophage like cell line RAW 264.7 is frequently used to initially assess the bioactivity of natural compounds and to envision their possible effect in primary cells or in vivo, we investigated whether this cell line would respond to APC treatment and co-treatment with LPS 28. Firstly, the cells were incubated with increasing concentrations of APC for 4 hours. After 4 hours, the cells were induced with ±LPS for 6 hours to determine if APC could suppress the production of the pro-inflammatory cytokines TNF-? and IL-6. Since IL-10 has been previously shown to inhibit a multitude of inflammatory cytokines including TNF-? and IL-6, the IL-10 protein levels produced by the cells were also examined by ELISA, to ascertain if the anticoagulant mediator APC increases the expression of this anti-inflammatory cytokine under inflammatory conditions 14.
Exposure to LPS led to a highly significant rise in IL-6 and TNF- ? production (p ; 0.0001). As expected, the positive control containing recombinant IL-10 substantially reduced the expression levels of both TNF-? and IL-6 (p ; 0.05) (Fig 3A, B). Incubation with APC had negligible effect on the protein levels of TNF-? across all concentrations (Fig 3A). The inhibition of IL-6 was the largest in 20nM and 30nM APC treated samples, thus suggesting a concentration-dependent suppression of IL-6 secretion from LPS-treated cells (Fig 3B) (p ; 0.05). We speculated that IL-10 may be influenced by APC, but treatment with APC did not significantly increase IL-10 secretion in RAW 264.7 cells (Fig 3C).

(B)

(C)
-447675103505Fig 3. Responsiveness of RAWS 264.7 to APC. Raw 264.7 cells were plated at 1 x 106/ml in a 96 well plate and incubated overnight in DMEM supplemented with serum at 37°C. The next day, cells were unstimulated or stimulated with rising concentrations of APC (5, 10, 20, 30nM) for 4 hrs. Afterwards, cells were treated with ± LPS (100ng/ml) or with IL-10 alone or IL-10 + LPS. Three biological replicates were set up and the supernatants were collected for TNF-?, IL-6 and IL-10 ELISA analysis. The data shown are expressed as the mean ± SD and p-values were generated by a Two-tailed t-test.
00Fig 3. Responsiveness of RAWS 264.7 to APC. Raw 264.7 cells were plated at 1 x 106/ml in a 96 well plate and incubated overnight in DMEM supplemented with serum at 37°C. The next day, cells were unstimulated or stimulated with rising concentrations of APC (5, 10, 20, 30nM) for 4 hrs. Afterwards, cells were treated with ± LPS (100ng/ml) or with IL-10 alone or IL-10 + LPS. Three biological replicates were set up and the supernatants were collected for TNF-?, IL-6 and IL-10 ELISA analysis. The data shown are expressed as the mean ± SD and p-values were generated by a Two-tailed t-test.

APC suppresses IL-6 secretion in RAW 264.7 cells
3810005774055Fig 4. The effect of APC on IL-6 secretion. RAW 264.7 macrophages plated at 1x 106/ml in a 96 well plate in complete DMEM and maintained at 37°C for one night. The cells were then cultured with increasing concentrations of APC (5, 10, 20, 30nM) for 4 hrs, followed by treatment with ± LPS (100ng/ml), or exogenous recombinant IL-10 (20ng/ml) alone. In the IL-10+LPS wells, IL-10 was added on before LPS. Each biological condition was replicated 3 times. IL-6 concentration in the supernatants was quantified by ELISA. The data collected are presented as the mean ± SD and p-values were determined by nonparametric two-tailed t-test.
00Fig 4. The effect of APC on IL-6 secretion. RAW 264.7 macrophages plated at 1x 106/ml in a 96 well plate in complete DMEM and maintained at 37°C for one night. The cells were then cultured with increasing concentrations of APC (5, 10, 20, 30nM) for 4 hrs, followed by treatment with ± LPS (100ng/ml), or exogenous recombinant IL-10 (20ng/ml) alone. In the IL-10+LPS wells, IL-10 was added on before LPS. Each biological condition was replicated 3 times. IL-6 concentration in the supernatants was quantified by ELISA. The data collected are presented as the mean ± SD and p-values were determined by nonparametric two-tailed t-test.
Incubation of RAW 264.7 cells with APC and co-stimulation with LPS was repeated to obtain a second independent experiment. To ensure that the cells and lysate harvested responded to stimulation, an IL-6 ELISA was performed. As shown in Fig. 4, the amount of IL-6 secreted by the cells remarkably surged from 438.64 pg/ml to 6024 pg/ml after LPS stimulation for 6 hours (p ; 0.001). As predicted, the results indicated a gradual decline in IL-6 release following treatment with increasing concentrations of APC, with 30nM dose inhibition being the greatest (p 0.0275). Exogenous IL-10 provided the greatest suppression of IL-6 cytokine production and was followed by the 30nM APC treated sample which was markedly significant (p ; 0.05).

The effect of APC on the secretion of pro- and anti-inflammatory cytokines
To corroborate our observations at the protein level (Fig 3, Fig 4), we carried out a real-time PCR to quantify TNF-?, IL-6 and IL-10 mRNA levels from the RNA samples obtained from the experiment described in Fig 4. Although not significant, the ELISA from Fig 4 indicated that 5nM and 10nM seemed to decrease IL-6 secretion slightly. As expected, induction with LPS raises TNF-, IL-6 and IL-10 gene expression, and promisingly APC lowered TNF- and IL-6 mRNA expression but also decreased IL-10 expression which was unexpected (Fig 5A, B, C).
TNF-? expression was diminished by 12±1-fold and IL-6 production was reduced by 18.3-fold and 14.53-fold in response to 5nM and 10nM of APC respectively (Fig 5A, B). Furthermore, we noted that the magnitude of IL-6 secretion in RAW 264.7 cells far exceeds that of TNF-? when stimulated with LPS and subsequently, the fold change in cytokine inhibition by the different concentrations of APC are greater in IL-6 (Fig 5A, B). While APC dramatically reduced the production of all cytokines it did not influence cytokine levels in basal conditions substantially. This confirms that APC inhibits TNF- and IL-6 production which was highlighted in Fig 3B and Fig 4, however the inhibition of IL-10 was unanticipated.

left-289250(A)
00(A)

-3371856430645Fig 5. The change in TNF-?, IL-6, and IL-10 mRNA levels in response to APC in LPS stimulated RAW 264.7 cells. Macrophages were plated at a density of 1 x 106 cells/ml in a 96 well plate and incubated overnight in complete DMEM at 37ºC. Cells were left NT or treated with specific concentrations of APC (5, 10, 20 and 30nM) for 4 hrs in an incubator. RAW 264.7 cells were then stimulated with ± LPS (100ng/ml), or with IL-10 (20ng/ml) or IL-10 + LPS for 6 hrs. Cells were lysed and the three biological replicates of each condition were pooled in the presence of 70% ethanol, to obtain adequate RNA. cDNA was generated and cytokine mRNA expression levels were evaluated using real-time PCR. mRNA expression was normalized to m18s house-keeping gene and ?Ct of non-treated cells. Fold change was calculated using the formula 2^??Ct. Relative expression is mean ± SD of three technical replicates of each sample.

00Fig 5. The change in TNF-?, IL-6, and IL-10 mRNA levels in response to APC in LPS stimulated RAW 264.7 cells. Macrophages were plated at a density of 1 x 106 cells/ml in a 96 well plate and incubated overnight in complete DMEM at 37ºC. Cells were left NT or treated with specific concentrations of APC (5, 10, 20 and 30nM) for 4 hrs in an incubator. RAW 264.7 cells were then stimulated with ± LPS (100ng/ml), or with IL-10 (20ng/ml) or IL-10 + LPS for 6 hrs. Cells were lysed and the three biological replicates of each condition were pooled in the presence of 70% ethanol, to obtain adequate RNA. cDNA was generated and cytokine mRNA expression levels were evaluated using real-time PCR. mRNA expression was normalized to m18s house-keeping gene and ?Ct of non-treated cells. Fold change was calculated using the formula 2^??Ct. Relative expression is mean ± SD of three technical replicates of each sample.

-6351856740(B)
00(B)
left4374944(C)
00(C)

The anti-inflammatory effect of APC on miR-155 expression
Following the analysis of the two previous experiments, we performed a real-time PCR to evaluate the impact of APC on miR-155 expression in LPS-treated RAW 264.7 macrophages. To do this, we merged the relative expression of miR-155 obtained from the second experiment (Fig 4, Fig 5) with another independent experiment to generate error bars and p-values. Existing literature have previously established that miR-155 is extensively up-regulated in RAW 264.7 cells, in response to LPS stimulation 42. In this study, we observed that induction with LPS resulted in a maximum 83.82-fold change in miR-155 expression in RAW 264.7 cells (Fig 6). The large error bar observed in the cells treated with LPS alone was due to the difference in fold change between the two experiments (14.38, 83.82-fold). Although not significant, incubation with rising doses of APC illustrated a decreasing trend in miR-155 production. This outcome provided the basis for the hypothesis that higher concentrations of APC may be required to obtain a more effective inhibition of miR-155 which we investigated further in Fig 8.

-544195235585Fig 6. Effect of APC on miR-155 synthesis in murine macrophages. RAW 264.7 cells were plated at 1 x 106 cells/ml in a 96 well plate and incubated overnight at 37ºC in complete DMEM. Cells were left NT or treated with increasing concentrations of APC (5, 10, 20 and 30nM) for 4 hrs in an incubator. Macrophages were then stimulated with ± LPS (100ng/ml), or with IL-10 + LPS for 6 hrs. Cells were then lysed and the three biological replicates of each condition were combined in the presence of 70% ethanol, to obtain adequate RNA. RNA was reverse transcribed to cDNA and miRNA expression levels were evaluated using real-time PCR. miRNA expression was normalized to sno202 house-keeping gene and ?Ct of non-treated cells. Fold change was calculated using the formula 2^??Ct and pooled with the results from independent experiment 1. Relative expression is expressed as the mean ± SD of three technical replicates of each sample.

00Fig 6. Effect of APC on miR-155 synthesis in murine macrophages. RAW 264.7 cells were plated at 1 x 106 cells/ml in a 96 well plate and incubated overnight at 37ºC in complete DMEM. Cells were left NT or treated with increasing concentrations of APC (5, 10, 20 and 30nM) for 4 hrs in an incubator. Macrophages were then stimulated with ± LPS (100ng/ml), or with IL-10 + LPS for 6 hrs. Cells were then lysed and the three biological replicates of each condition were combined in the presence of 70% ethanol, to obtain adequate RNA. RNA was reverse transcribed to cDNA and miRNA expression levels were evaluated using real-time PCR. miRNA expression was normalized to sno202 house-keeping gene and ?Ct of non-treated cells. Fold change was calculated using the formula 2^??Ct and pooled with the results from independent experiment 1. Relative expression is expressed as the mean ± SD of three technical replicates of each sample.

Cytokine protein expression in response to higher concentrations of APC
We investigated the ability of higher concentrations of APC to counteract LPS-induced production of IL-6 and TNF- and reduction of IL-10. As anticipated, treatment with LPS substantially elevated cytokine production in RAW 264.7 macrophages (p ? 0.001) (Fig 7). Our data show that incubation with higher doses of APC (30, 60 and 90nM) had no differential effect on TNF-? protein levels, thus indicating an opposite trend to that observed in response to lower doses of APC (Fig 7A, Fig5A). Although not statistically significant, IL-6 protein expression showed a consistent decline in a dose-dependent manner with 90nM APC treated cells suggesting a downward trend in IL-6 cytokine release (p ? 0.3868) (Fig 7B).

IL-10 expression did not substantially increase in response to higher doses of APC (Fig 7C). These results indicate that higher doses of APC concentration above 90nM may be required to provide statistical significance in driving IL-10 and down-regulating IL-6 and TNF- in LPS stimulated macrophages. To support this theory, a study examining the effect of APC on IL-10 protein production in LPS-treated human monocytes, previously demonstrated that a dose of 120nM APC provided a greater induction of IL-10 in comparison to 30nM and 60nM APC which equally didn’t have a significant impact 23.
0188595(A)
00(A)

01701800(B)
00(B)

00(C)
00(C)

-561975143510Fig 7. The effect of APC on TNF-?, IL-6 and IL-10 protein production in LPS-stimulated RAW 264.7 cell line. Cells were plated at a suspension (5 x 105 cells/well) in a 96 well plate and incubated overnight in complete DMEM at 37ºC. Cells were then left NT or treated with specific concentrations of APC (30, 60, 90nM) for 4 hrs in an incubator. Following this, macrophages were stimulated with ± LPS (100ng/ml), or with IL-10 + LPS for 6 hrs. Each biological condition was replicated 3 times and cytokine concentration in the supernatants was quantified by ELISA. The data collected are presented as the mean ± SD and p-values were determined by nonparametric two-tailed t-test.
00Fig 7. The effect of APC on TNF-?, IL-6 and IL-10 protein production in LPS-stimulated RAW 264.7 cell line. Cells were plated at a suspension (5 x 105 cells/well) in a 96 well plate and incubated overnight in complete DMEM at 37ºC. Cells were then left NT or treated with specific concentrations of APC (30, 60, 90nM) for 4 hrs in an incubator. Following this, macrophages were stimulated with ± LPS (100ng/ml), or with IL-10 + LPS for 6 hrs. Each biological condition was replicated 3 times and cytokine concentration in the supernatants was quantified by ELISA. The data collected are presented as the mean ± SD and p-values were determined by nonparametric two-tailed t-test.

The expression of miR-155 in response to higher doses of APCTreatment of RAW 264.7 macrophages with higher doses of APC in the presence of LPS revealed that 30nM, 60nM and 90nM concentrations did not down-regulate miR-155 microRNA levels substantially (Fig 8). This outcome is in line with the cytokine expression data observed in Fig 7. In addition, exposure to LPS, resulted in a 30-fold induction in miR-155 expression (p < 0.0001) (Fig 8). It has been confirmed that in healthy human macrophages, miR-155 elicits an unprompted production of multiple pro-inflammatory cytokines such as TNF-? and IL-6 whilst simultaneously reducing IL-10 synthesis 2. Hence, when overexpressed, miR-155 drives a more potent pro-inflammatory response, which would suggest why 90nM APC may not have been sufficient enough to counterbalance LPS-stimulated miR-155 activity.

center167950Fig 8. Effect of APC on miR-155 synthesis in murine macrophages. RAW 264.7 cells were plated at 1 x 106 cells/ml in a 24 well plate and incubated overnight at 37ºC in complete DMEM. Cells were left NT or treated with rising concentrations of APC (30, 60,90nM) for 4 hrs. Macrophages were then stimulated with ± LPS (100ng/ml), or with IL-10 + LPS for 6 hrs. Three biological replicates of each condition were set up. Cells were then lysed and RNA was harvested using 100% ethanol. RNA was reverse transcribed to cDNA and miRNA expression levels were evaluated using real-time PCR and quantified using the Ct method. miRNA expression was normalized to sno202 house-keeping gene and ?Ct of non-treated cells. Fold change was calculated using the formula 2^??Ct. Relative expression is expressed as the mean ± SD of three technical replicates of each sample.

00Fig 8. Effect of APC on miR-155 synthesis in murine macrophages. RAW 264.7 cells were plated at 1 x 106 cells/ml in a 24 well plate and incubated overnight at 37ºC in complete DMEM. Cells were left NT or treated with rising concentrations of APC (30, 60,90nM) for 4 hrs. Macrophages were then stimulated with ± LPS (100ng/ml), or with IL-10 + LPS for 6 hrs. Three biological replicates of each condition were set up. Cells were then lysed and RNA was harvested using 100% ethanol. RNA was reverse transcribed to cDNA and miRNA expression levels were evaluated using real-time PCR and quantified using the Ct method. miRNA expression was normalized to sno202 house-keeping gene and ?Ct of non-treated cells. Fold change was calculated using the formula 2^??Ct. Relative expression is expressed as the mean ± SD of three technical replicates of each sample.

The effect of APC on LPS-stimulated BMDMs
Having examined the effects of both low and high concentrations of APC in LPS-stimulated RAW 246.7 cells, we turned to focus on BMDMs as they represent a suitable model of an in vitro environment 44. Since miR-155 promotes an M1 phenotype in activated macrophages and both miR-155 and M1 macrophages are induced by LPS, we performed an ELISA assay to examine the inhibitory effect of APC on cytokine production by LPS-stimulated BMDMs 25, 44. The ELISA analysis showed no significant suppression of TNF-? and IL-6 release (Fig 9A, B). In addition, APC did not greatly influence IL-10 protein levels in response to pro-inflammatory conditions (Fig 9C). As a result, we discontinued the further use of BMDMs in APC expression studies.
00(A)
00(A)

00(B)
00(B)

3810014605(C)
00(C)

357505363220Fig 9. Changes in TNF-?, IL-6, and IL-10 protein levels in response to APC in LPS stimulated BMDMs. Macrophages were plated at a suspension (2 x 105 cells/well) in a 96 well plate and incubated overnight in complete DMEM at 37ºC. Cells were kept NT or treated with various concentrations of APC (30, 60, 90nM) for 4 hrs. Macrophages were then stimulated with ± LPS (100ng/ml), or with IL-10 (20ng/ml) or with IL-10 + LPS for 6 hrs. Each biological condition was replicated 3 times and cytokine concentration in the supernatants was measured by ELISA. The data collected are presented as the mean ± SD and p-values were determined by nonparametric two-tailed t-test.
00Fig 9. Changes in TNF-?, IL-6, and IL-10 protein levels in response to APC in LPS stimulated BMDMs. Macrophages were plated at a suspension (2 x 105 cells/well) in a 96 well plate and incubated overnight in complete DMEM at 37ºC. Cells were kept NT or treated with various concentrations of APC (30, 60, 90nM) for 4 hrs. Macrophages were then stimulated with ± LPS (100ng/ml), or with IL-10 (20ng/ml) or with IL-10 + LPS for 6 hrs. Each biological condition was replicated 3 times and cytokine concentration in the supernatants was measured by ELISA. The data collected are presented as the mean ± SD and p-values were determined by nonparametric two-tailed t-test.

The efficiency of APC inhibition in serum versus serum-free media
Published research has shown that APC may function more efficiently in serum-free media 9. To maximize the anti-inflammatory impact of APC, we conducted our experimental setup in two distinct medias. Fig 10A highlights RAW 264.7 cells cultured in DMEM supplemented with FBS whereas in Fig 10B the cells were grown in DMEM without serum. This experiment revealed that APC inhibits miR-155 in a dose-dependent manner with the serum-free media providing the largest fold-reduction from LPS alone to 20nM APC (6.35-fold). Based on this outcome we repeated this experiment in three biological replicates to generate accurate statistics.

right244017(A)
00(A)

363962810899(B)
00(B)

center266153Fig 10. APC inhibits miR-155 production in a dose-dependent manner. RAW 264.7 cells were plated at 0.6 x 106 cells/ml in a 96 well plate and incubated overnight at 37ºC in complete DMEM or in SFM-DMEM. Cells were left NT or treated with rising concentrations of APC (5, 20nM) for 4 hrs. Macrophages were then stimulated with ± LPS (100ng/ml), or with IL-10 + LPS for 6 hrs. Cells were then lysed and the three biological replicates of each condition were combined in the presence of 70% ethanol, to obtain adequate RNA. RNA was reverse transcribed to cDNA and miR-155 expression levels were evaluated using real-time PCR. miR-155 expression was normalized to sno202 house-keeping gene and to the ?Ct of each individual untreated sample. Relative expression is expressed as the mean ± SD of three technical replicates of each sample. Fold change was calculated using the formula 2^??Ct.

00Fig 10. APC inhibits miR-155 production in a dose-dependent manner. RAW 264.7 cells were plated at 0.6 x 106 cells/ml in a 96 well plate and incubated overnight at 37ºC in complete DMEM or in SFM-DMEM. Cells were left NT or treated with rising concentrations of APC (5, 20nM) for 4 hrs. Macrophages were then stimulated with ± LPS (100ng/ml), or with IL-10 + LPS for 6 hrs. Cells were then lysed and the three biological replicates of each condition were combined in the presence of 70% ethanol, to obtain adequate RNA. RNA was reverse transcribed to cDNA and miR-155 expression levels were evaluated using real-time PCR. miR-155 expression was normalized to sno202 house-keeping gene and to the ?Ct of each individual untreated sample. Relative expression is expressed as the mean ± SD of three technical replicates of each sample. Fold change was calculated using the formula 2^??Ct.

APC efficiently suppresses miR-155 in serum-free media
To further validate our observations (section 3.8) we carried out a repeat experiment shown in Fig 10, using a 24 well plate to obtain three independent biological replicates. Fig 11 illustrates that 5nM and 20nM APC dampen the expression of LPS-stimulated miR-155 by 3.4- and 2.16-fold respectively. Although not statistically significant, when compared to samples treated with LPS only, these doses of APC also provide a higher inhibition of miR-155 than exogenous IL-10, which is a known inhibitor of miR-155 induction thus suggesting that serum-free media is a suitable medium for APC efficiency (p 0.07) 26. We also detected that LPS did not drive miR-155 as efficiently as previous experiments, (83-fold in Fig 6, 30-fold in Fig 8 and 136-fold in Fig 10B), thus implying that a repeat experiment should be conducted to achieve statistical significance.

-523875163830Fig 11. APC suppresses miR-155 synthesis in LPS-stimulated RAW 264.7 cells. RAW 264.7 cells were plated at 1 x 106 cells/ml in a 24 well plate and incubated overnight at 37ºC in SFM-DMEM. Cells were kept NT or treated with 5 and 20nM concentration of APC for 4 hrs. Macrophages were then stimulated with ± LPS (100ng/ml), or with IL-10 + LPS for 6 hrs. Three biological replicates of each condition were set up. Cells were then lysed and RNA was harvested using 70% ethanol. RNA was reverse transcribed to cDNA and miRNA expression levels were evaluated using real-time PCR. miRNA expression was normalized to sno202 house-keeping gene and the ?Ct of their individual NT sample. Relative expression is expressed as the mean ± SD of three technical replicates of each sample. Fold change was calculated using the formula 2^??Ct.

00Fig 11. APC suppresses miR-155 synthesis in LPS-stimulated RAW 264.7 cells. RAW 264.7 cells were plated at 1 x 106 cells/ml in a 24 well plate and incubated overnight at 37ºC in SFM-DMEM. Cells were kept NT or treated with 5 and 20nM concentration of APC for 4 hrs. Macrophages were then stimulated with ± LPS (100ng/ml), or with IL-10 + LPS for 6 hrs. Three biological replicates of each condition were set up. Cells were then lysed and RNA was harvested using 70% ethanol. RNA was reverse transcribed to cDNA and miRNA expression levels were evaluated using real-time PCR. miRNA expression was normalized to sno202 house-keeping gene and the ?Ct of their individual NT sample. Relative expression is expressed as the mean ± SD of three technical replicates of each sample. Fold change was calculated using the formula 2^??Ct.

Inactivation of APC active site impairs its anti-inflammatory ability
A previous study examining the effect of active-site blocked APC (PPACK-APC) on IL-10 protein levels, established that in comparison to APC, PPACK-APC did not drive IL-10 secretion in LPS treated conditions 23. Based on this knowledge, we incorporated PPACK-APC in our miR-155 study, to gain further insight into whether the enzyme activity of APC plays an important role in down-regulating miR-155. Hence, miR-155 microRNA levels were quantified in the presence of LPS alone, LPS with 5nM APC and LPS with 5nM inactivated-APC. Our findings showed that there was a significant difference between 5nM APC and 5nM PPACK-APC (p 0.0234). With APC displaying effective suppression this indicated that APC necessitates its serine protease function to exert inhibitory activity.
-434172367940Fig 12. The impact of APC and PPACK-APC on miR-155 expression in RAW 264.7 cells. RAW 264.7 cells were plated at 1 x 106 cells/ml in a 24 well plate and incubated overnight at 37ºC in SFM-DMEM. Cells were kept NT or treated with 5nM APC or 5nM PPACK-APC for 4 hrs. Macrophages were then stimulated with ± LPS (100ng/ml), or with IL-10 + LPS for 6 hrs. Three biological replicates of each condition were set up. Cells were then lysed and RNA was harvested using 70% ethanol. RNA was reverse transcribed to cDNA and miRNA expression levels were ascertained using real-time PCR. miRNA expression was normalized to sno202 house-keeping gene and the ?Ct of their individual non-treated sample. Relative expression is expressed as the mean ± SD of three technical replicates of each sample. Fold change was calculated using the formula 2^??Ct.

00Fig 12. The impact of APC and PPACK-APC on miR-155 expression in RAW 264.7 cells. RAW 264.7 cells were plated at 1 x 106 cells/ml in a 24 well plate and incubated overnight at 37ºC in SFM-DMEM. Cells were kept NT or treated with 5nM APC or 5nM PPACK-APC for 4 hrs. Macrophages were then stimulated with ± LPS (100ng/ml), or with IL-10 + LPS for 6 hrs. Three biological replicates of each condition were set up. Cells were then lysed and RNA was harvested using 70% ethanol. RNA was reverse transcribed to cDNA and miRNA expression levels were ascertained using real-time PCR. miRNA expression was normalized to sno202 house-keeping gene and the ?Ct of their individual non-treated sample. Relative expression is expressed as the mean ± SD of three technical replicates of each sample. Fold change was calculated using the formula 2^??Ct.

Discussion
Multiple sclerosis, the most widespread neurodegenerative disease is an autoimmune inflammatory disorder characterized by lesions in the brain and spinal cord 20, 29. In addition to neurological complications, people with MS frequently experience serious physical or cognitive disabilities 29. Clinical studies dictate that leukocyte invasion of the brain tissue incites demyelination, inflammation and development of sclerotic lesions, which are a trademark of MS. Furthermore, it has been reported that the induction of pro-inflammatory cytokines is fundamental for the control of leukocyte movement through the blood-brain barrier 20.
Indeed, APC is an essential serine protease which is derived from the zymogen protein C (PC) on endothelial cells. Initiation of PC is most favorably achieved on endothelial cell surfaces following the engagement of PC with the EPCR, with the inducer thrombin being coupled to thrombomodulin on the endothelial cell. Following initiation, APC obstructs both intra-extracellular coagulation signaling pathways by blocking the cleavage of the procoagulant cofactors Factor V and Factor VIII, thus reducing the transformation of prothrombin to thrombin 9. Supplementary to its anticoagulant properties, APC also exerts a variety of anti-inflammatory and cytoprotective responses including regulation of neutrophil migration, inhibition of PAR1 dependent monocyte apoptosis and macrophage stimulation reliant on Mac-1 integrin 23, 38.
miR-155 is a circulating miRNA which is referred to as a master regulator of MS due to its numerous implications in MS studies 18. For instance, it was determined that the peripheral blood mononuclear cells (PBMCs) extracted from the blood samples of MS patients have elevated levels of miR-155. Another paper also disclosed that 10 out of 24 people with RRMS exhibited up-regulated levels of miR-155 25. In addition to this, McCoy et al., have shown that IL-10 inhibits miR-155 induction in response to TLR4 stimulation with LPS 26. Based on these studies provided, we hypothesized that APC may serve as an anti-inflammatory mediator of miR-155 overexpression and its signature pro-inflammatory responses. In doing so, we speculated that APC could suppress the pro-inflammatory cytokines IL-6 and TNF- while simultaneously promoting IL-10 cytokine synthesis and secretion to combat the pro-inflammatory signals driven miR-155.
This project revealed that APC decreases the expression of IL-6 in LPS-stimulated macrophages in a dose-dependent manner, as shown by the significant reduction of IL-6 protein expression. This is consistent with existing data that APC can effectively impede leukocyte production of pro-inflammatory cytokine IL-6 9, 23. Contrastingly, our protein expression results indicated that APC did not have a noticeable effect on TNF- protein levels. Although APC has been previously demonstrated to effectively inhibit TNF- production in THP-1 human monocytic cell line, we were unable to reproduce this outcome in RAW 264.7 murine macrophages. It must be noted however that the experiment conducted in THP-1 monocytes applied an APC concentration of 50?g/ml to achieve 60% inhibition of TNF- secretion which is 1667-times greater than our maximum dose of 30nM APC 41. Albeit, IL-10 protein levels were not substantially up-regulated, pretreatment with increasing concentrations of APC alone gradually elevated IL-10 expression in basal conditions.
In an effort to further examine the impact of APC on pro-inflammatory cytokines produced in response to LPS induction, we analyzed the cytokine expression levels at the mRNA level. The data suggested that APC down-regulated both TNF- and IL-6 gene expression in cells cultured with LPS. In addition, the IL-10 mRNA results displayed an upward trend with each increasing dose of APC. This suggests that APC exerts a greater effect at the mRNA level than the protein level. Further research could be conducted to examine the differential effect of APC on pro-inflammatory cytokines at the nuclear and cytoplasmic level.
We then sought to investigate whether higher concentrations of APC (30-90nM) conferred a greater degree of suppression. Our initial investigation revealed that treatment with higher doses of APC did not exhibit any substantial inhibition in TNF- cytokine secretion. Although not statistically relevant, the maximum dose of APC marginally reduced IL-6 release in a dose-related manner, and this slight indication in the statistics suggested that the higher dose was beginning to take effect. This coincides with a previous study where Galley et al., showed that APC could inhibit IL-6 release from LPS-induced human neutrophils in a dosage-dependent pattern with the highest dose of 200nM APC obtaining 50% reduction without altering auxiliary cytokines Galley et al., 2008. Of importance, this study successfully blocked the migration of neutrophils towards chemoattractants. Thus, it may be worth exploring macrophage migration towards chemokines that are known to be upregulated in MS, following treatment with APC and endotoxin.
Furthermore, the induction of IL-10 protein levels following treatment with the higher doses of APC (30-90nM) and co-treatment with LPS displayed an immense induction of IL-10 protein levels. This validated our speculation that APC drives IL-10 in a dose-dependent manner. In a recent study examining the influence of APC on IL-10, it was determined that a dose of 120nM APC facilitated a substantial induction of IL-10 compared to 30nM and 60nM APC which did not elicit a significant effect, thus further consolidating our interpretation 23. Ultimately, this suggested that an APC concentration above 90nM may be needed to generate a statistically significant inhibition of IL-6 and TNF- at the protein level, and to also drive IL-10 cytokine production in LPS-induced macrophages.
Evidently, all existing literature seem to point towards the impression that higher doses of APC exhibit a greater impact. Hence, it would be worth repeating this experiment again with the same concentrations or within a new range between 120 – 200nM, which has been shown to be successful according to published data 23, Galley et al., 2008. Issues that may have led to the development of high signals in our ELISA may be due to prolonged incubation times, inadequate washing or low sample dilution, resulting in a small amount of target protein in the wells.

Based on our hypothesis that APC inhibits miR-155, we assessed the impact of APC on miR-155 mRNA. We noted that, treatment of LPS-induced cells with rising doses of APC (5-30nM) resulted in a descending trend in miR-155 synthesis. This observation however, was not significant, which gave us the assumption that higher doses of APC may be required to achieve a significant inhibition of miR-155 expression. In regard to the higher doses of APC (30-90nM), the reduction of miR-155 WAS NOT statistically significant. Given that miR-155 naturally evokes pro-inflammatory cytokine production in healthy macrophages, we assumed that under LPS conditions, miR-155 would be in overdrive and thus would necessitate a more potent concentration of APC to be suppressed 2. One possible reason as to why the experiment was more efficient at the lower concentrations compared to the higher concentrations may be due to counter reactivity between higher doses of APC and the serum in the media. It has been previously reported that in LPS-stimulated THP-1 monocytic cells, the ability of APC to suppress TNF- production was hindered by the presence of 1-10% serum and that effective inhibition could only be achieved by raising APC concentrations to an extent above normal physiological levels, thus indicating the existence of serum-related APC inhibitors Schmidt-Supprian et al., 2000. This leads us to speculate whether the lower doses of APC go under the radar of analytes or inhibitors in the serum containing media. Certainly, this is an area which should be explored further. Another probable cause for this outcome may have been due to the use of cell culture media supplemented with serum from different batches in the two experiments. This variation may have been caused by the non-specific nature of the nutrients in the serum and therefore may have affected our efforts to reproduce the same outcome in the higher doses.
Multiple studies have reported that APC may function more effectively in serum-free media (SFM). Schmidt-Supprian and colleagues illustrated that THP-1 monocytes treated with APC in SFM generated a significant decrease in the secretion of TNF-, but failed to reproduce the same outcome in media supplemented with 1-10% serum 41. Taking this into consideration, we performed a miR-155 real-time PCR to compare the efficiency of APC (5, 20nM) inhibition in serum versus SFM. In line with our hypothesis, our results confirmed that APC inhibits miR-155 in a concentration-dependent manner, in both types of media, by displaying a gradual decrease in response to increasing concentrations of APC. Interestingly, the fold induction of miR-155 with LPS alone was far greater in the cells cultured in SFM compared to the fold change observed in cells grown in media containing serum, which may be due to interactions between analytes in the serum and APC.
Accredited literatures have proposed that serum derived from animals provide a non-specific reservoir of growth factors and nutrients. Moreover, it is postulated that incubation with animal-derived serum may have experimental effects, such as mounting an immune response against unfamiliar serum proteins. This outcome has previously been demonstrated in an experiment involving dendritic cells grown in fetal calf serum, which substantially improved the anti-tumor responses in the absence of a tumor antigen Bouwer et al., 2010.
By utilizing SFM however, we are able to control the cell milieu by keeping the conditions in which the cells are cultured in consistent. Hence, when repeated we can replicate this outcome. Taking this into consideration, SFM may be a more efficient media for cell culture due to the absence of interfering components or unforeseen inhibitors of APC and thus, we can expect that APC will generate a more efficient result.

Based on these finding, we carried out three independent biological replicates and confirmed that APC (5, 20nM) reduced the production of LPS-induced miR-155 in murine macrophages, thus validating our hypothesis. Despite not being statistically significant, APC appears to considerably suppress LPS-induced miR-155 in comparison to LPS alone. In the absence of the stimulant, miR-155 is not affected by APC treatment in basal conditions. This suggests that APC may only switch on in the presence of a familiar stimulant and does not independently downregulate miR-155 overexpression, which could be investigated further.
It has been revealed that the proteolysis of zymogen PC at Arginine 169 by thrombin eliminates the initiation peptide and produces APC. Moreover, APC is described to be a serine protease that resembles trypsin due to an archetypal serine proteases active site triad which consists of Histidine 211, Asparagine 257 and a Serine residue at position 260 Griffin et al., 2007. When the inhibitor PPACK is introduced to APC, it covalently attaches to the active site of APC at positions Serine 195 and Histidine 57, which outline the S1, S2 and S4 (aryl binding) pockets. Of importance, the substrate binding site maintains an unclosed conformation and is easily susceptible to inhibitors Mather et al., 1996. Hence as expected, the addition of PPACK to APC resulted in a loss of enzymatic ability to suppress miR-155. By doing so, we effectively compared the effect of active-site blocked APC on miR-155 to the magnitude of inhibition exerted by APC when fully functional, which was evidently more efficient, thus consolidating our hypothesis that APC can obstruct miR-155 expression.
Future plans
Future research into the impact of APC on miR-155 will expand the present therapeutic strategies for MS and possibly other inflammatory diseases. Although this study has confirmed that APC suppresses miR-155 expression, experiments where only one biological replicate was generated must be repeat to strengthen our body of work. For future experiments, it would be interesting to examine whether APC inhibition of miR-155 is carried out via Mac-1 or EPCR- dependent cleavage of PAR1 using a PAR1 inhibitor or NIF.
Conclusion
The obscure etiology, immune system intricacy and phenotypic heterogeneity will continue to present difficulties in the quest to find effective treatment for MS. In conclusion, APC is an essential anticoagulant and anti-inflammatory mediator implicated in numerous biological processes and confers antiapoptotic and cytoprotective responses. Contrarily, miR-155 has been associated with various inflammatory diseases and is a driving factor in Th1 and Th17 responses, thus its overproduction can determinantal. We set out to determine whether APC the administration of APC could possibly counteract the pro-inflammatory responses driven by miR-155 expression and we found that APC suppresses IL-6 cytokine production as well as TNF- and IL-6 mRNA expression in a dose-dependent manner. Moreover, this study provides conceptual data showing the inhibitory effects of APC on miR-155. We presented the evidence that the APC active site is pivotal for its functionality and suppression of mir-155. Taking together our studies, we provide novel insight into the ability of APC to regulate miR-155 expression and its pro-inflammatory response. Taking these results into account, developing an APC-related immunotherapy targeting miR-155, to treat MS could be highly beneficial.

References
1 Alabanza, L. M., Esmon, N. L., Esmon, C. T. & Bynoe, M. S. Inhibition of Endogenous Activated Protein C Attenuates Experimental Autoimmune Encephalomyelitis by Inducing Myeloid-Derived Suppressor Cells. The Journal of Immunology, vol. 191, no. 7, 2013, pp.3764–3777.

2 Alivernini S, Gremese E, McSharry C, Tolusso B, Ferraccioli G, McInnes IB and Kurowska-Stolarska M (2018) MicroRNA-155—at the Critical Interface of Innate and Adaptive Immunity in Arthritis. Front. Immunol. 8: 1932.
3 Ambros, Victor. The functions of animal microRNAs. Nature, vol. 431, no. 7006, 2004, pp. 350–355.

4 Austin, K.M., Covic, L. & Kuliopulos, A. (2012). Matrix metalloproteases and PAR1 activation. Blood, 121(3):431–439.

5 Bartel, David P. MicroRNAs: Genomics, Biogenesis, Mechanism, and Function. Cell, vol. 116, no. 2, 2004, pp.281–297.

6 Beecham AH, Patsopoulos NA, Xifara DK, Davis MF, Kemppinen A, Cotsapas C et al. Analysis of immune-related loci identifies 48 new susceptibility variants for multiple sclerosis. Nat Genet, vol. 45, no. 11, 2013, pp.1353–1360.
7 Belbasis, Lazaros, et al. “Environmental Risk Factors and Multiple Sclerosis: an Umbrella Review of Systematic Reviews and Meta-Analyses.” The Lancet Neurology, vol. 14, no. 3, 2015, pp. 263–273.

8 Bruning U, Cerone L, Neufeld Z, Fitzpatrick SF, Cheong A et al. MicroRNA-155 promotes resolution of hypoxia-inducible factor 1alpha activity during prolonged hypoxia. Molecular and Cellular Biology, vol. 31, no. 19, 2011, pp. 4087–4096.

9 Cao C, Gao Y, Li Y, Antalis TM, Castellino FJ, Zhang L (2010) The efficacy of activated protein C in murine endotoxemia is dependent on integrin CD11b. J Clin Invest. 120: 1971-1980.
10 Cheung ST, So EY, Chang D, Ming-Lum A, Mui AL-F. Interleukin-10 Inhibits Lipopolysaccharide Induced miR-155 Precursor Stability and Maturation. PLoS ONE, vol. 8, no. 8, Dec. 2013.

11 Daniel J. Cua, Beth Hutchins, Drake M. LaFace, Stephen A. Stohlman and Robert L. Coffman. Transgenic Interleukin 10 Prevents Induction of Experimental Autoimmune Encephalomyelitis. The Journal of Experimental Medicine, vol. 189, no. 6, 1999, pp. 1005–1010.

12 Espana, F, Medina P, Navarro S, Zorio E, Estellés A, Aznar J. The Multifunctional Protein C System. Current Medicinal Chemistry-Cardiovascular & Hematological Agents, vol. 3, no. 2, 2005, pp. 119–131.

13 Fink K, Busch HJ, Bourgeois N, Schwarz M, Wolf D, Zirlik A, Peter K, Bode C, von Zur Muhlen C. (2013). Mac-1 Directly Binds to the Endothelial Protein CReceptor: A Link between the Protein C Anticoagulant Pathway and Inflammation? PLoS One. 8:2:e53103.

14 Fiorentino, D. F., A. Zlotnik, T. R. Mosmann, M. Howard, and A. O’Garra (1991) IL-10 inhibits cytokine production by activated macrophages. J. Immunol. 147: 3815–3822
15 Homorodean R, Leucuta DC, Perju-Dumbrava L. Fatigue in multiple sclerosis. HVM Bioflux, vol. 8, no. 3, 2016, pp. 148-153.

16 I. Huitinga, N. Van Rooijen, C.J.A. de Groot, B.M.J. Uitdehaag, C.D. Dijkstra. Suppression of Experimental Allergic Encephalomyelitis in Lewis Rats after Elimination of Macrophages. Journal of Experimental Medicine, vol. 172, no. 4, Jan. 1990, pp. 1025–1033.
17 Jablonski KA, Gaudet AD, Amici SA, Popovich PG, Guerau-de-Arellano M. Control of the Inflammatory Macrophage Transcriptional Signature by MiR-155. Plos One, vol. 11, no. 7, 2016.

18 Jagot, F., ; Davoust, N. (2016). Is It Worth Considering Circulating microRNAs in Multiple Sclerosis? Frontiers in Immunology, 7:129
19 Jiang Z, Jiang JX, Zhang GX. Macrophages: a double-edged sword in experimental autoimmune encephalomyelitis. Immunology Letters, vol. 160, no 1, 2014, pp. 17-22
20 Khaibullin, T., Ivanova, V., Martynova, E., Cherepnev, G., Khabirov, F., Granatov, E.,… Khaiboullina, S. (2017). Elevated Levels of Proinflammatory Cytokines in Cerebrospinal Fluid of Multiple Sclerosis Patients. Frontiers in Immunology. 8:531.
21 Kluiver J, Poppema S, de Jong D, Blokzijl T, Harms G, Jacobs S, Kroesen BJ, van den Berg A. BIC and miR-155 are highly expressed in Hodgkin, primary mediastinal and diffuse large B cell lymphomas. J Pathol, vol. 207, no. 2, 2005, pp. 243–249
22 Li, Zhonghan, and Tariq M. Rana. Therapeutic targeting of microRNAs: current status and future challenges. Nature Reviews Drug Discovery, vol. 13, no. 8, 11 July 2014, pp. 622–638.

23 Lisa J. Toltl, Suzanne Beaudin and Patricia C (2008) Activated Protein C Up-Regulates IL-10 and Inhibits Tissue Factor in Blood Monocytes. J Immunol. 181: 2165-2173.

24 Martinez-Nunez RT, Louafi F, Sanchez-Elsner T. The interleukin 13 (IL-13) pathway in human macrophages is modulated by microRNA-155 via direct targeting of interleukin 13 receptor alpha1 (IL13Ralpha1). J Biol Chem, vol. 286, no. 3, 2011, pp.1786–1794.

25 McCoy CE (2017) miR-155 Dysregulation and Therapeutic Intervention in Multiple Sclerosis. Adv Exp Med Biol. 1024: 111-131.

26 McCoy CE, Sheedy FJ, Qualls JE, Doyle SL, Quinn SR, Murray PJ, and O’Neill LA (2010) IL-10 inhibits miR-155 induction by toll-like receptors. J Biol Chem. 285: 20492-8.

27 McDonnell CJ, Soule EE, Walsh PT, O’Donnell JS, Preston RJS. The Immunoregulatory Activities of Activated Protein C in Inflammatory Disease. Semin Thromb Hemost. vol. 44, no. 2, 2018, pp. 167-175.
28 Merly, Liza, and Sylvia L. Smith (2017) Murine RAW 264.7 Cell Line as an Immune Target: Are We Missing Something? Immunopharmacology and Immunotoxicology, 39: 55 – 58
29 Nazem Ghasemi, Shahnaz Razavi, and Elham Nikzad. (2017). Multiple Sclerosis: Pathogenesis, Symptoms, Diagnoses and Cell-Based Therapy. Cell Journal (Yakhteh), 19:1-10
30 Neyrinck AP, Liu KD, Howard JP, Matthay MA. Protective mechanisms of activated protein C in severe inflammatory disorders. Br J Pharmacol, vol. 158, no.4, 2009, pp.1034–1047.

31 Noorbakhsh F, Ellestad KK, Maingat F, Warren KG, Han MH, Steinman L, Baker GB, Power C. Impaired neurosteroid synthesis in multiple sclerosis. Brain, vol. 134, 2011, pp.2703–2721.
32 O’Connell RM, Taganov KD, Boldin MP, Cheng G, Baltimore D. MicroRNA-155 is induced during the macrophage inflammatory response. Proc Natl Acad Sci U S A, vol. 104, no. 5, 2007, pp. 1604-1609.
33 Podolnikova NP, Kushchayeva YS, Wu Y, Faust J, Ugarova TP. (2016). The Role of Integrins ?M?2 (Mac-1, CD11b/CD18) and ?D?2 (CD11d/CD18) in Macrophage Fusion. The American Journal of Pathology. 186(8):2105-2116
34 Poser S, Stickel B, Krtsch U, Burckhardt D, Nordman B. Increasing incidence of multiple sclerosis: in South Lower Saxony Germany. Neuroepidemiology 1989; 8: 207–213.

35 Pugliatti M, Rosati G, Carton H, Riise T, Drulovic J, Vécsei L, Milanov I. The epidemiology of multiple sclerosis in Europe European Journal of Neurology, vol. 13, no. 7, 2006, pp. 700–722.

36 Riewald M, Petrovan RJ, Donner A, Mueller BM, Ruf W. (2002). Activation of endothelial cell protease activated receptor 1 by the protein C pathway. Science 296(5574):1880–1882
37 Roy RV, Ardeshirylajimi A, Dinarvand P, Yang L, Rezaie AR. (2016). Occupancy of human EPCR by protein C induces?-arrestin-2biased PAR1 signaling by both APC and thrombin. Blood. 128(14):1884–1893
38 Ruf, W., 2010. New players in the sepsis-protective activated protein C pathway. Journal of Clinical Investigation, 120(9), pp.3084–3087.

39 Samoilova EB, Horton JL, Chen Y. Acceleration of experimental autoimmune encephalomyelitis in interleukin-10-deficient mice: roles of interleukin-10 in disease progression and recovery. Cellular Immunology, vol. 188, no. 2, 1998, pp. 118–124.

40 Sarangi PP, H Lee, M Kim. Activated Protein C Action in Inflammation. British Journal of Haematology, vol. 148, no. 6, 2010, pp. 817–833.

41 Schmidt-Supprian M, Murphy C, While B, Lawler M, Kapurniotu A, Voelter W, Smith O, Bernhagen J. (2000). Activated protein C inhibits tumor necrosis factor and macrophage migration inhibitory factor production in monocytes. Eur Cytokine Netw. 11(3):407-13
42 Shashi Bala, Miguel Marcos, Karen Kodys, Timea Csak, Donna Catalano, Pranoti Mandrekar, and Gyongyi Szabo (2010) Up-regulation of MicroRNA-155 in Macrophages Contributes to increased Tumor Necrosis Factor ? (TNF-?) production via increased mRNA half-life in alcoholic liver disease. J. Biological Chemistry. 286: 1436 – 1444.

43 Xu K, Lin J, Zandi R, Roth JA, Ji L. (2016). MicroRNA-Mediated target mRNA cleavage and 3?-Uridylation in human cells. Scientific Reports. 6(1).
44 Ying W, Cheruku PS, Bazer FW, Safe SH, Zhou B (2013) Investigation of macrophage polarization using bone marrow derived macrophages. J Vis Exp. (76).